KIAA0899

Product ID	ORK00678
Accession No	AB020706
Description	adaptor-related protein complex 2, alpha 2 subunit, transcript variant 2
Clone name	hk09548s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a synthetic oligonucleotide (1-60) was subcloned upstream of the cDNA (61-4434). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCAATACGC GT-5' end of cDNA.
cDNA sequence	DNA sequence (4434 bp) Predicted protein sequence (939 aa)
HaloTag ORF Clone	FHC00678
Flexi ORF Clone	FXC00678
Source	Human adult brain
Rouge ID	mKIAA0899 by Kazusa Mouse cDNA Project
Note	We replaced hk09548, former representative clones for KIAA0899 with hk09548s1. (2002/5/10)

Length: 4434 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1614 bp
Genome contig ID	gi51511727f_816022
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ACTCCTCGTCAAAGAAAAATAAAGGCTAGAACTGC
Flanking genome sequence (186219 - 186268)	----+--------+--------+--------+--------+----* ACCCCGGATCACGCGCTTTCTTTGGGGGGAAAGCATCCCATGTAACCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	916022	1002239	22	99.5	Perfect prediction

Length: 939 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD97278	99.9	adaptor-related...	Homo sapiens
BAH13015	99.9	unnamed protein...	Homo sapiens
CAH90132	98.9	hypothetical pr...	Pongo abelii
BAC40392	97.4	unnamed protein...	Mus musculus
AAH58099	97.3	Adaptor protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002553	29	590	PF01602	Clathrin/coatomer adaptor
	IPR008152	707	820	PF02883	Clathrin adaptor
	IPR003164	826	938	PF02296	Clathrin adaptor
HMMSmart	IPR008152	707	820	SM00809	Clathrin adaptor

Primer_f	AATGTCTGCGGCTCTTCTTCC
Primer_r	TGAGAATGAGGGCCACACCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATGTCTGCGGCTCTTCTTCC
Primer_r	TGAGAATGAGGGCCACACCAC
PCR product length	164 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles