Order Kazusa clone(s) from : ![]() |
Product ID | ORK00143 |
---|---|
Accession No | AB020707 |
Description | WAS protein family, member 3, transcript variant 1 |
Clone name | hk09606s1 |
Vector information | |
cDNA sequence | DNA sequence (4705 bp) Predicted protein sequence (503 aa) |
HaloTag ORF Clone |
FHC00143
![]() |
Flexi ORF Clone | FXC00143 |
Source | Human adult brain |
Rouge ID |
mKIAA0900
by Kazusa Mouse cDNA Project
|
Note | We replaced hk09606, former representative clones for KIAA0900 with hk09606s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3082 bp |
---|---|
Genome contig ID | gi51511729f_25985097 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (175968 - 176017) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 13 | f | 26085094 | 26161063 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AGAACACAGAAGCTACTATCC |
---|---|
Primer_r | AGCTACAGGAAGACAACTAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |