KIAA0900

Product ID	ORK00143
Accession No	AB020707
Description	WAS protein family, member 3, transcript variant 1
Clone name	hk09606s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA-5' end of cDNA. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4705 bp) Predicted protein sequence (503 aa)
HaloTag ORF Clone	FHC00143
Flexi ORF Clone	FXC00143
Source	Human adult brain
Rouge ID	mKIAA0900 by Kazusa Mouse cDNA Project
Note	We replaced hk09606, former representative clones for KIAA0900 with hk09606s1. (2002/5/10)

Length: 4705 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3082 bp
Genome contig ID	gi51511729f_25985097
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAGTAACATCTAAATAAAATTACACTTTTAACCCT
Flanking genome sequence (175968 - 176017)	----+--------+--------+--------+--------+----* AAGAGGTTTTGCTTATTAATAACAGTGTTGTATGTTTGGCTTTTTTGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	f	26085094	26161063	9	99.2	Perfect prediction

Length: 503 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPY6	1.4e-121	100.0	Wiskott-Aldrich...	Homo sapiens
XP_509596	2.2e-121	99.8	WAS protein fam...	Pan troglodytes
XP_001093804	3.4e-121	99.6	similar to WAS ...	Macaca mulatta
AAL51032	1.4e-120	99.6	WAVE3 [Homo sap...	Homo sapiens
XP_001491134	1.8e-117	96.4	WAS protein fam...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87459	1.5e-19	50.0	KIAA0269

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	441	458	PF02205	Actin-binding WH2
HMMSmart	IPR003124	441	458	SM00246	Actin-binding WH2
ProfileScan	IPR003124	441	458	PS51082	Actin-binding WH2

Primer_f	AGAACACAGAAGCTACTATCC
Primer_r	AGCTACAGGAAGACAACTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-