KIAA0269

Product ID	ORK00484
Accession No	D87459
Description	WAS protein family, member 1, transcript variant 1
Clone name	ha06751
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2625 bp) Predicted protein sequence (567 aa)
HaloTag ORF Clone	FHC00484
Flexi ORF Clone	FXC00484
Source	Human adult brain

Length: 2625 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	703 bp
Genome contig ID	gi89161210r_110427715
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CAGTCTGATTTAATAAATGGTTCATTTTAAAAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CATCAGTGTTGCTCTTTGAATAAAATGATTTATCATAATTTATCAAATAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	110527715	110606609	10	99.7	Perfect prediction

Length: 567 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW48330	2e-136	99.3	WAS protein fam...	Homo sapiens
Q92558	3.6e-136	100.0	Wiskott-Aldrich...	Homo sapiens
Q5NVG8	5.9e-136	99.8	Wiskott-Aldrich...	Pongo abelii
XP_001504068	7.7e-136	99.5	similar to Wisk...	Equus caballus
XP_532260	1.3e-135	99.5	similar to Wisk...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020707	6.2e-19	49.9	KIAA0900

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	505	522	PF02205	Actin-binding WH2
HMMSmart	IPR003124	505	522	SM00246	Actin-binding WH2
ProfileScan	IPR003124	505	522	PS51082	Actin-binding WH2

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGAGCCTTATTCCATTTCCTG
Primer_r	AGGGGATACTGCTAAACATTC
PCR product length	182 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles