Gene/Protein Characteristic Table for KIAA0901
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01133
Accession No AB020708
Description histone deacetylase 6
Clone name hk09716
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4078 bp)
Predicted protein sequence (1233 aa)
Flexi ORF Clone FXC01133
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 4078 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 358 bp
Genome contig ID gi89161218f_48445452
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GGCAAGGTTGCATATGTAATAAAGTACAAGCTGTT
Flanking genome sequence
(122874 - 122923)
----+----*----+----*----+----*----+----*----+----*
AAAAAACCTGGAGAAAGCTTTTTGACTTTGAGCAGGTGGAGAACCCCACA
Features of the protein sequence
Description

Length: 1233 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG64088 0 100.0 unnamed protein...
Homo sapiens
EAW50744 0 100.0 histone deacety...
Homo sapiens
Q9UBN7 0 100.0 Histone deacety...
Homo sapiens
AAH69243 0 99.9 HDAC6 protein [...
Homo sapiens
AAD29048 0 99.9 histone deacety...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB006626 1e-30 45.8 KIAA0288
AB011172 8.5e-29 46.9 KIAA0600
AB023220 0.001 29.6 KIAA1003
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000286 625 648 PR01270 Histone deacetylase superfamily
IPR000286 660 675 PR01270 Histone deacetylase superfamily
IPR000286 750 760 PR01270 Histone deacetylase superfamily
HMMPfam IPR000286 103 422 PF00850 Histone deacetylase superfamily
IPR000286 498 818 PF00850 Histone deacetylase superfamily
IPR001607 1151 1222 PF02148 Zinc finger
HMMSmart IPR001607 1150 1199 SM00290 Zinc finger
ProfileScan IPR001607 1149 1210 PS50271 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CCCATCCTGAATATCCTTTGC
Primer_r TTCTGGGCTGGAGTAGTGGTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name UniGene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp