Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01133 |
---|---|
Accession No | AB020708 |
Description | histone deacetylase 6 |
Clone name | hk09716 |
Vector information | |
cDNA sequence | DNA sequence (4078 bp) Predicted protein sequence (1233 aa) |
HaloTag ORF Clone |
FHC01133
|
Flexi ORF Clone | FXC01133 |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 358 bp |
---|---|
Genome contig ID | gi89161218f_48445452 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (122874 - 122923) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000286 | 625 | 648 | PR01270 | Histone deacetylase superfamily |
IPR000286 | 660 | 675 | PR01270 | Histone deacetylase superfamily | |
IPR000286 | 750 | 760 | PR01270 | Histone deacetylase superfamily | |
HMMPfam | IPR000286 | 103 | 422 | PF00850 | Histone deacetylase superfamily |
IPR000286 | 498 | 818 | PF00850 | Histone deacetylase superfamily | |
IPR001607 | 1151 | 1222 | PF02148 | Zinc finger | |
HMMSmart | IPR001607 | 1150 | 1199 | SM00290 | Zinc finger |
ProfileScan | IPR001607 | 1149 | 1210 | PS50271 | Zinc finger |
RT-PCR-ELISA |
Primer_f | CCCATCCTGAATATCCTTTGC |
---|---|
Primer_r | TTCTGGGCTGGAGTAGTGGTG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |