KIAA1003

Product ID	ORK00164
Accession No	AB023220
Description	ubiquitin specific peptidase 20, transcript variant 1
Clone name	hk09911
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4252 bp) Predicted protein sequence (917 aa)
HaloTag ORF Clone	FHC00164
Flexi ORF Clone	FXC00164
Source	Human adult brain
Rouge ID	mKIAA1003 by Kazusa Mouse cDNA Project

Length: 4252 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1378 bp
Genome contig ID	gi89161216f_131551910
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- GTTCAAAATGTCAGAATAAACACAGAATAAATGTT
Flanking genome sequence (132020 - 132069)	----+--------+--------+--------+--------+----* CCCACGGCCACACAGTCGTCTCTCCTTCACTGCAGTTCTGTTACTGGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	131651909	131683928	25	99.3	Perfect prediction

Length: 917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW87911	99.9	ubiquitin speci...	Homo sapiens
AAL79676	100.0	pVHL-interactin...	Homo sapiens
AAH39593	99.9	Ubiquitin speci...	Homo sapiens
Q9Y2K6	99.8	Ubiquitin carbo...	Homo sapiens
XP_520313	99.3	ubiquitin speci...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029020	3e-125	60.0	KIAA1097
D29956	2.1e-11	29.8	KIAA0055
AB011101	4.7e-10	23.9	KIAA0529
AB020698	1.2e-08	24.5	KIAA0891
AB028986	1.4e-08	31.1	KIAA1063

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001607	34	110	PF02148	Zinc finger
HMMPfam	IPR001394	146	685	PF00443	Peptidase C19
HMMSmart	IPR001607	33	85	SM00290	Zinc finger
	IPR006615	705	788	SM00695	Ubiquitin carboxyl-terminal hydrolase
	IPR006615	813	898	SM00695	Ubiquitin carboxyl-terminal hydrolase
ProfileScan	IPR001607	32	96	PS50271	Zinc finger
ProfileScan	IPR001394	149	689	PS50235	Peptidase C19
ScanRegExp	IPR001394	150	165	PS00972	Peptidase C19
ScanRegExp	IPR001394	630	647	PS00973	Peptidase C19

Primer_f	CCCCACACTACTGCGTCTTTG
Primer_r	ACAGAAGATCCGAAAAGTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCCCACACTACTGCGTCTTTG
Primer_r	ACAGAAGATCCGAAAAGTGAG
PCR product length	114 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles