KIAA0891

Product ID	ORK01614
Accession No	AB020698
Description	ubiquitin specific peptidase 19, transcript variant 4
Clone name	hk08201
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4401 bp) Predicted protein sequence (1371 aa)
HaloTag ORF Clone	FHC01614
Flexi ORF Clone	FXC01614
Source	Human adult brain
Rouge ID	mKIAA0891 by Kazusa Mouse cDNA Project

Length: 4401 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	283 bp
Genome contig ID	gi89161205r_49021112
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTAAAAGTGTTAATAAAACCAGACTATTCAGGCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCTCGTCTCTCTGTCTCAACGCCGCTGCTGTCTGCGCCTGCCTTGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	49121112	49133217	26	99.9	Perfect prediction

Length: 1371 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516454	99.2	ubiquitin speci...	Pan troglodytes
O94966	100.0	Ubiquitin carbo...	Homo sapiens
EAW64955	99.9	ubiquitin speci...	Homo sapiens
EAW64957	98.5	ubiquitin speci...	Homo sapiens
AAH82241	97.2	USP19 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011101	8.5e-32	35.8	KIAA0529
D29956	2.4e-21	38.1	KIAA0055
AB023220	1.4e-08	24.5	KIAA1003
AB029020	6.8e-06	22.9	KIAA1097
AB046814	1.7e-05	25.6	KIAA1594

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007052	169	244	PF04969	CS
	IPR015054	248	546	PF08959	Domain of unknown function DUF1872
	IPR001394	547	1264	PF00443	Peptidase C19
	IPR002893	844	886	PF01753	Zinc finger
ProfileScan	IPR007052	166	255	PS51203	CS
	IPR007052	335	437	PS51203	CS
	IPR001394	550	1268	PS50235	Peptidase C19
	IPR002893	844	886	PS50865	Zinc finger
ScanRegExp	IPR001394	551	566	PS00972	Peptidase C19
	IPR002893	844	886	PS01360	Zinc finger
	IPR001394	1202	1219	PS00973	Peptidase C19

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	AGCGGLARLSVPCWRIWPQRAAK	23	SECONDARY	23
SOSUI2	2	1342	LRYFVLGTVAALVALVLNVFYPL	1364	PRIMARY	23

Primer_f	CATGCCTGCCTTTGTTGTGGG
Primer_r	AGAGCAGCAGGATGAATGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCCATGCCTGCCTTTGTTGTG
Primer_r	CAGACAGCCAGATGGATACAC
PCR product length	135 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles