KIAA1594

Product ID	ORK07316
Accession No	AB046814
Description	ubiquitin specific peptidase 37
Clone name	fj09468
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4450 bp) Predicted protein sequence (931 aa)
Source	Human fetal brain
Rouge ID	mKIAA1594 by Kazusa Mouse cDNA Project

Length: 4450 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1652 bp
Genome contig ID	gi89161199r_218926341
PolyA signal sequence (None)	+--------+--------+----*----+---- GCAGTCTGAGTGACAGAGTGAGACTCCATCTCATT
Flanking genome sequence (99904 - 99855)	----+--------+--------+--------+--------+----* AAAAAAAACGAAAACAAAAACAAAAAAAACACAAACCATCATCACAGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	219026245	219126695	22	99.6	Terminal No-hit

Length: 931 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW70621	100.0	ubiquitin speci...	Homo sapiens
CAL38294	99.9	hypothetical pr...	synthetic construct
AAI44250	99.9	USP37 protein [...	Homo sapiens
XP_516090	99.8	hypothetical pr...	Pan troglodytes
CAL37807	99.7	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020698	1.9e-05	25.4	KIAA0891
AB011101	5.1e-05	21.5	KIAA0529

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	290	900	PF00443	Peptidase C19
	IPR003903	655	672	PF02809	Ubiquitin interacting motif
	IPR003903	757	774	PF02809	Ubiquitin interacting motif
	IPR003903	779	796	PF02809	Ubiquitin interacting motif
HMMSmart	IPR003903	603	622	SM00726	Ubiquitin interacting motif
	IPR003903	656	675	SM00726	Ubiquitin interacting motif
	IPR003903	758	777	SM00726	Ubiquitin interacting motif
	IPR003903	780	799	SM00726	Ubiquitin interacting motif
ProfileScan	IPR001394	293	904	PS50235	Peptidase C19
	IPR003903	656	675	PS50330	Ubiquitin interacting motif
	IPR003903	758	777	PS50330	Ubiquitin interacting motif
	IPR003903	780	799	PS50330	Ubiquitin interacting motif
ScanRegExp	IPR001394	294	309	PS00972	Peptidase C19
ScanRegExp	IPR001394	841	859	PS00973	Peptidase C19

Primer_f	TGGGTTCTGATGAGGACTCTG
Primer_r	GACCTGAAGAAGAAGTGCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TGGGTTCTGATGAGGACTCTG
Primer_r	GACCTGAAGAAGAAGTGCTAC
PCR product length	162(2k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles