Order Kazusa clone(s) from : ![]() |
Product ID | ORK00553 |
---|---|
Accession No | AB011101 |
Description | ubiquitin specific peptidase 15, transcript variant 2 |
Clone name | hg02898s1 |
Vector information | |
cDNA sequence | DNA sequence (4602 bp) Predicted protein sequence (952 aa) |
HaloTag ORF Clone |
FHC00553
![]() |
Flexi ORF Clone | FXC00553 |
Source | Human adult brain |
Rouge ID |
mKIAA0529
by Kazusa Mouse cDNA Project
|
Note | We replaced hg02898, former representative clones for KIAA0529 with hg02898s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1743 bp |
---|---|
Genome contig ID | gi89161190f_60840463 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (245704 - 245753) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 60940463 | 61086165 | 21 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010460 | 78 | 223 | PF06337 | Ubiquitin carboxyl-terminal hydrolase |
IPR001394 | 257 | 901 | PF00443 | Peptidase C19 | |
HMMSmart | IPR006615 | 23 | 121 | SM00695 | Ubiquitin carboxyl-terminal hydrolase |
ProfileScan | IPR001394 | 260 | 905 | PS50235 | Peptidase C19 |
ScanRegExp | IPR001394 | 261 | 276 | PS00972 | Peptidase C19 |
IPR001394 | 846 | 863 | PS00973 | Peptidase C19 |
![]() |
---|
Primer_f | TTCTTTGTGTGTTCCTGATGG |
---|---|
Primer_r | CCTGGATCCTTGAATGTGGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCTTTGTGTGTTCCTGATGG |
Primer_r | CCTGGATCCTTGAATGTGGTG |
PCR product length | 168 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |