Order Kazusa clone(s) from : ![]() |
Product ID | ORK01051 |
---|---|
Accession No | D29956 |
Description | ubiquitin specific peptidase 8, transcript variant 1 |
Clone name | ha01049 |
Vector information | |
cDNA sequence | DNA sequence (4359 bp) Predicted protein sequence (1120 aa) |
HaloTag ORF Clone |
FHC01051
![]() |
Flexi ORF Clone | FXC01051 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0055
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 685 bp |
---|---|
Genome contig ID | gi51511731f_48403892 |
PolyA signal sequence (ATTAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (175373 - 175422) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 48503892 | 48579263 | 20 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR015063 | 8 | 115 | PF08969 | Domain of unknown function DUF1873 |
IPR001763 | 186 | 309 | PF00581 | Rhodanese-like | |
IPR001394 | 776 | 1108 | PF00443 | Peptidase C19 | |
ProfileScan | IPR001763 | 197 | 315 | PS50206 | Rhodanese-like |
IPR001394 | 779 | 1112 | PS50235 | Peptidase C19 | |
ScanRegExp | IPR001394 | 780 | 795 | PS00972 | Peptidase C19 |
IPR001448 | 825 | 834 | PS00304 | Small acid-soluble spore protein | |
IPR001394 | 1053 | 1070 | PS00973 | Peptidase C19 |
Panel name | Genebridge 4 |
---|---|
Primer_f | TATTGCAGTGCCTATGTAACG |
Primer_r | TACCAAATTCTTCTGCCACTT |
PCR product length | 123 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |