KIAA0055

Product ID	ORK01051
Accession No	D29956
Description	ubiquitin specific peptidase 8, transcript variant 1
Clone name	ha01049
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4359 bp) Predicted protein sequence (1120 aa)
HaloTag ORF Clone	FHC01051
Flexi ORF Clone	FXC01051
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0055 by Kazusa Mouse cDNA Project

Length: 4359 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	685 bp
Genome contig ID	gi51511731f_48403892
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- ATTTACAGCTACATTAAAATCTTAATGAGAAAAAT
Flanking genome sequence (175373 - 175422)	----+--------+--------+--------+--------+----* AATTTATAACCCTGTGGGTGTTCTGTCTTTAATATTGTATTATCAAATAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	48503892	48579263	20	99.7	Perfect prediction

Length: 1120 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P40818	100.0	Ubiquitin carbo...	Homo sapiens
BAF85089	99.8	unnamed protein...	Homo sapiens
CAD97662	99.7	hypothetical pr...	Homo sapiens
XP_001168710	99.6	ubiquitin speci...	Pan troglodytes
XP_001114466	98.4	ubiquitin speci...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011101	1.7e-13	41.8	KIAA0529
AB020698	1.7e-12	38.1	KIAA0891
AB029020	1.4e-06	32.7	KIAA1097
AB023220	4.1e-06	29.8	KIAA1003
AB028986	1.5e-05	29.9	KIAA1063

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015063	8	115	PF08969	Domain of unknown function DUF1873
	IPR001763	186	309	PF00581	Rhodanese-like
	IPR001394	776	1108	PF00443	Peptidase C19
ProfileScan	IPR001763	197	315	PS50206	Rhodanese-like
ProfileScan	IPR001394	779	1112	PS50235	Peptidase C19
ScanRegExp	IPR001394	780	795	PS00972	Peptidase C19
	IPR001448	825	834	PS00304	Small acid-soluble spore protein
	IPR001394	1053	1070	PS00973	Peptidase C19

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TATTGCAGTGCCTATGTAACG
Primer_r	TACCAAATTCTTCTGCCACTT
PCR product length	123 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles