KIAA1063

Product ID	ORK07311
Accession No	AB028986
Description	ubiquitin specific peptidase 22
Clone name	hj04848
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5223 bp) Predicted protein sequence (593 aa)
Source	Human adult brain
Rouge ID	mKIAA1063 by Kazusa Mouse cDNA Project

Length: 5223 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3441 bp
Genome contig ID	gi51511734r_20743502
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTCTCCTATGTCATAATAAAGCTACATTTTCTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAACTGGCCAGTTTTCCTTTTATTGACACAAGCAGCCGAAGAGAGGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	20843502	20886944	13	99.3	Perfect prediction

Length: 593 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UPT9	8.4e-184	100.0	Ubiquitin carbo...	Homo sapiens
Q5DU02	5.4e-181	97.9	Ubiquitin carbo...	Mus musculus
AAH80737	9.9e-181	97.7	Ubiquitin speci...	Mus musculus
BAE36137	1.4e-180	97.7	unnamed protein...	Mus musculus
XP_586712	2.2e-180	90.8	similar to ubiq...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29956	8.2e-07	30.4	KIAA0055
AB040886	1e-06	29.4	KIAA1453
AB023220	1.8e-05	31.1	KIAA1003

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001607	131	200	PF02148	Zinc finger
HMMPfam	IPR001394	241	585	PF00443	Peptidase C19
ProfileScan	IPR001607	129	189	PS50271	Zinc finger
ProfileScan	IPR001394	244	589	PS50235	Peptidase C19
ScanRegExp	IPR001394	245	260	PS00972	Peptidase C19
ScanRegExp	IPR001394	531	548	PS00973	Peptidase C19

Primer_f	ATGACTGTGCTGTGGTTGGAG
Primer_r	GAGAGACTACAAAGCACTGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATGACTGTGCTGTGGTTGGAG
Primer_r	GAGAGACTACAAAGCACTGGG
PCR product length	113 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles