KIAA1103

Gene/Protein Characteristic Table for KIAA1103

Order Kazusa clone(s) from :

Product ID	ORK07051
Accession No	AB029026
Description	transforming, acidic coiled-coil containing protein 1
Clone name	hk10190
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4117 bp) Predicted protein sequence (453 aa)
Source	Human adult brain

Length: 4117 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2753 bp
Genome contig ID	gi51511724f_38697007
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACTCCATCCTGGGTGACAGCAAGATCTTGTCTC
Flanking genome sequence (130445 - 130494)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAACCAGGAGTGAAAAAGGAAAGTAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	38797007	38827450	12	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001171527	9.9e-150	99.8	transforming, a...	Pan troglodytes
EAW63294	3.4e-125	99.5	transforming, a...	Homo sapiens
AAK68658	5.8e-116	99.5	gastric cancer ...	Homo sapiens
XP_001506072	7.6e-112	78.9	similar to TACC...	Ornithorhynchus...
XP_001171560	3.2e-111	99.4	transforming, a...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007707	245	451	PF05010	Transforming acidic coiled-coil-containing

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGACCCCTTAAGAACCTGACC
Primer_r	GAGGAGGCATCTGTTAAGTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 8

Experimental conditions

Panel name	GeneBridge 4
Primer_f	AGACCCCTTAAGAACCTGACC
Primer_r	GAGGAGGCATCTGTTAAGTTC
PCR product length	146 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp