KIAA1903

Product ID	ORK04318
Accession No	AB067490
Description	MIS18 binding protein 1
Clone name	hk10325
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4382 bp) Predicted protein sequence (1014 aa)
Source	Human adult brain
Rouge ID	mKIAA1903 by Kazusa Mouse cDNA Project

Length: 4382 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	523 bp
Genome contig ID	gi51511730r_44642540
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- ATTACACATTGTTGAAATTAAATTACACATTGTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATGCTTCTCTCCTGATTGTTTTTATTTTAAACTTGTGATAGGCATATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	44742540	44792355	17	99.7	Perfect prediction

Length: 1014 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6P0N0	0	99.7	Mis18-binding p...	Homo sapiens
XP_522841	0	98.4	chromosome 14 o...	Pan troglodytes
XP_001151604	0	98.2	chromosome 14 o...	Pan troglodytes
XP_001915365	4.7e-139	73.7	similar to chro...	Equus caballus
XP_001925327	7.7e-121	65.0	similar to chro...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015216	265	357	PF09133	SANT associated
HMMPfam	IPR014778	759	808	PF00249	Myb
HMMSmart	IPR001005	758	810	SM00717	SANT
ProfileScan	IPR001005	762	804	PS50090	SANT

Primer_f	CATGAGGTATAATCTGTCCGC
Primer_r	TAAGTAAGTCACGTTCATCGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-