KIAA1717

Product ID	ORK00270
Accession No	AB051504
Description	SET domain containing (lysine methyltransferase) 7, transcript variant 1
Clone name	pf00208
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6992 bp) Predicted protein sequence (420 aa)
HaloTag ORF Clone	FHC00270
Flexi ORF Clone	FXC00270
Source	Human brain (hippocampus)
Rouge ID	mKIAA1717 by Kazusa Mouse cDNA Project

Length: 6992 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5624 bp
Genome contig ID	gi89161207r_140546643
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- AGAAACAATGCAAGTATTAAACAAAATATACAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTGTCATTGTCTTCCTTTGGTCATCTAGGTTAGAAAAGCAATAATGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	140646643	140697008	8	99.2	Perfect prediction

Length: 420 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001088778	4.7e-145	99.0	similar to SET ...	Macaca mulatta
Q8WTS6	2.1e-125	100.0	Histone-lysine ...	Homo sapiens
XP_533287	5.9e-123	90.3	similar to SET ...	Canis lupus fam...
XP_001138145	1.4e-121	89.8	SET domain-cont...	Pan troglodytes
EDM14980	2e-121	95.9	rCG49977, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003409	90	112	PF02493	MORN motif
	IPR003409	113	135	PF02493	MORN motif
	IPR003409	160	182	PF02493	MORN motif
	IPR001214	266	397	PF00856	SET
HMMSmart	IPR001214	268	396	SM00317	SET
ProfileScan	IPR001214	269	394	PS50280	SET

Primer_f	CAAAAGTTAACCCCATCACGG
Primer_r	TCATGCACCCAGACACACTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-