KIAA1718

Gene/Protein Characteristic Table for KIAA1718

Order Kazusa clone(s) from :

Product ID	ORK05558
Accession No	AB051505
Description	lysine (K)-specific demethylase 7A
Clone name	pf00323
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7480 bp) Predicted protein sequence (377 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1718 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 7480 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	6345 bp
Genome contig ID	gi89161213r_139331017
PolyA signal sequence (AAGAAA,-27)	+--------+--------+----*----+---- GTCCTTGAAAGAAAAAGAATCTGAATTCTATATCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTCTGACTTTGTTCCCTTTTTCTGCTGATTGAATCATGGGAAATTATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	139431017	139446239	8	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 377 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW83941	1e-137	99.7	hCG16420, isofo...	Homo sapiens
EAW83942	1.1e-137	99.7	hCG16420, isofo...	Homo sapiens
Q6ZMT4	1.2e-137	99.7	JmjC domain-con...	Homo sapiens
XP_001109325	2.6e-131	95.8	similar to PHD ...	Macaca mulatta
XP_001496558	8.9e-124	90.5	jumonji C domai...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TACCTATGCAAGACCTGTGAC
Primer_r	TCTTGGAGGAAAACAGCTGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 7

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp