KIAA1875

Product ID	ORK05725
Accession No	AB058778
Description	Homo sapiens mRNA for KIAA1875 protein, partial cds.
Clone name	pf00972
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7119 bp) Predicted protein sequence (922 aa)
Source	Human brain (hippocampus)

Length: 7119 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2022 bp
Genome contig ID	gi51511724f_145134617
PolyA signal sequence (AATAGA,-21)	+--------+--------+----*----+---- ACTACAGCCTCGGCAATAGAGCGAGACTCTGTGTC
Flanking genome sequence (110591 - 110640)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAATTATCTAGTTTAGGCCGGGTGTGGTGGCTCACGCCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	145234617	145245206	23	99.0	Perfect prediction

Length: 922 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB70740	0	99.2	hypothetical pr...	Homo sapiens
EAW82149	7.2e-151	99.8	hCG2040155 [Hom...	Homo sapiens
XP_001155567	4.8e-145	96.5	hypothetical pr...	Pan troglodytes
BAC85899	4.7e-128	94.0	unnamed protein...	Homo sapiens
XP_001155629	2.8e-122	90.9	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GGAGTTTCAGTGGCCATGTGG
Primer_r	GGAGAGGAAAGTGCTAAGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 8

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GGAGTTTCAGTGGCCATGTGG
Primer_r	GGAGAGGAAAGTGCTAAGGTC
PCR product length	95 bp
PCR conditions	15 °C66 sec60 °C30 sec150 cycles