Order Kazusa clone(s) from : ![]() |
Product ID | ORK00038 |
---|---|
Accession No | D86985 |
Description | KIAA0232, transcript variant 1 |
Clone name | pf00983 |
Vector information | |
cDNA sequence | DNA sequence (7840 bp) Predicted protein sequence (1402 aa) |
HaloTag ORF Clone |
FHC00038
![]() |
Flexi ORF Clone | FXC00038 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA0232
by Kazusa Mouse cDNA Project
|
Note | We replaced ha02598, former representative clones for KIAA0232 with pf00983. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3197 bp |
---|---|
Genome contig ID | gi89161207f_6757149 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (179644 - 179693) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | f | 6835368 | 6936791 | 10 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | GGCAAACGCTGAAACGCACTG |
Primer_r | TCAGAACAATACAACCACGGG |
PCR product length | 112 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |