Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01698 |
---|---|
Accession No | AB058743 |
Description | spastic paraplegia 11 (autosomal recessive), transcript variant 1 |
Clone name | pf01011 |
Vector information | |
cDNA sequence | DNA sequence (7752 bp) Predicted protein sequence (2443 aa) |
HaloTag ORF Clone |
FHC01698
|
Flexi ORF Clone | FXC01698 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1840
by Kazusa Mouse cDNA Project
|
Note | We replaced fj19761, former representative clones for KIAA1840 with pf01011. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 419 bp |
---|---|
Genome contig ID | gi51511731r_42542192 |
PolyA signal sequence (AATAAA,-16) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 42642192 | 42743138 | 40 | 99.9 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR001360 | 482 | 490 | PS00572 | Glycoside hydrolase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 19 | TAAMGRVLPMLLVPVPAEAMGQL | 41 | SECONDARY | 23 | 2 | 172 | VILHIIFPERDAAIRVLNCFTLP | 194 | SECONDARY | 23 | 3 | 208 | LCRGILFVLSSLGWIYIFDVVDG | 230 | PRIMARY | 23 | 4 | 1471 | SVLASCLQGASAISCLCVWIITS | 1493 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | ACATGCTCACAGATAACCACC |
---|---|
Primer_r | GTTTGATGTAGTCCAGCAGGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |