KIAA1685

Product ID	ORK00266
Accession No	AB051472
Description	additional sex combs like transcriptional regulator 2
Clone name	pf04287
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7174 bp) Predicted protein sequence (1505 aa)
HaloTag ORF Clone	FHC00266
Flexi ORF Clone	FXC00266
Source	Human brain (hippocampus)
Rouge ID	mKIAA1685 by Kazusa Mouse cDNA Project
Note	We replaced fh25856, former representative clones for KIAA1685 with pf04287. (2001/2/07)

Length: 7174 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2645 bp
Genome contig ID	gi89161199r_25715757
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAGCCATTCATCTTAAAAGCTGAACAGAAAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACACATTACAATCTGGCCTTTTAGAAAATGAAGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	25815757	25954816	12	100.0	Perfect prediction

Length: 1505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515337	99.3	additional sex ...	Pan troglodytes
Q76L83	100.0	Putative Polyco...	Homo sapiens
CAI45930	99.9	hypothetical pr...	Homo sapiens
BAD00088	99.9	chimeric MOZ-AS...	Homo sapiens
XP_001084149	96.7	similar to addi...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023195	6.6e-13	28.3	KIAA0978

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CGCCTTCGAAATGTTACTGCC
Primer_r	CTCTTTCTAGTCTCATTACCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-