KIAA1866

Product ID	ORK00290
Accession No	AB058769
Description	fibronectin type III domain containing 1
Clone name	pf09734
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6016 bp) Predicted protein sequence (1783 aa)
HaloTag ORF Clone	FHC00290
Flexi ORF Clone	FXC00290
Source	Human brain (hippocampus)
Rouge ID	mKIAA1866 by Kazusa Mouse cDNA Project
Note	We replaced fj14461, former representative clones for KIAA1866 with pf09734. (2005/08/06)

Length: 6016 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	663 bp
Genome contig ID	gi89161210f_159438467
PolyA signal sequence (ATTAAA,-31)	+--------+--------+----*----+---- ATTGATTAAAATTGCTAAATTTGTACTTGTTCACC
Flanking genome sequence (174662 - 174711)	----+--------+--------+--------+--------+----* AGATAAATGTGTGTGGGAATTTTTGGGCAAAAGTATTGTGTATTAACATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	159538467	159613127	21	99.0	Perfect prediction

Length: 1783 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAX14958	99.3	fibronectin typ...	Homo sapiens
AAI46784	100.0	FNDC1 protein [...	Homo sapiens
Q4ZHG4	96.3	Fibronectin typ...	Homo sapiens
AAY26234	96.2	expressed in sy...	Homo sapiens
CAX14843	95.9	fibronectin typ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003961	13	81	PF00041	Fibronectin
	IPR003961	116	199	PF00041	Fibronectin
	IPR003961	218	305	PF00041	Fibronectin
	IPR003961	1544	1631	PF00041	Fibronectin
HMMSmart	IPR003961	1	78	SM00060	Fibronectin
	IPR003961	116	199	SM00060	Fibronectin
	IPR003961	218	302	SM00060	Fibronectin
	IPR003961	1545	1628	SM00060	Fibronectin
ProfileScan	IPR003961	1	87	PS50853	Fibronectin
	IPR003961	116	208	PS50853	Fibronectin
	IPR003961	217	312	PS50853	Fibronectin
	IPR003961	1544	1638	PS50853	Fibronectin

Primer_f	AACAACCACAGTCCGAACCAC
Primer_r	TCATCTTCTTCAGCGTAGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-