KIAA0934

Product ID	ORK00688
Accession No	AB023151
Description	disco-interacting protein 2 homolog C
Clone name	pg00224
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6594 bp) Predicted protein sequence (1585 aa)
Flexi ORF Clone	FXC00688
Source	Human brain (hippocampus)
Rouge ID	mKIAA0934 by Kazusa Mouse cDNA Project
Note	We replaced hh04363, former representative clones for KIAA0934 with pg00224. (2002/5/10)

Length: 6594 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1835 bp
Genome contig ID	gi89161187r_211432
PolyA signal sequence (None)	+--------+--------+----*----+---- TGTTTGACTTCTGAGATCCAAGGCTGATTGTTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGTGGCACATTTAAAAAAATGTGTCTGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	311432	725606	37	99.6	Perfect prediction

Length: 1585 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y2E4	100.0	Disco-interacti...	Homo sapiens
AAI37788	99.3	Dip2c protein [...	Mus musculus
XP_001509877	98.7	similar to DIP2...	Ornithorhynchus...
XP_615139	98.5	similar to Disc...	Bos taurus
NP_001074895	98.7	DIP2 disco-inte...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040896	0	76.9	KIAA1463
D80006	0	81.6	KIAA0184

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010506	36	149	PF06464	DMAP1-binding
	IPR000873	380	526	PF00501	AMP-dependent synthetase and ligase
	IPR000873	733	832	PF00501	AMP-dependent synthetase and ligase
	IPR000873	1032	1504	PF00501	AMP-dependent synthetase and ligase

Primer_f	TTAGGTTGGCAAATAGCACTG
Primer_r	TTAAGACGAGGGGACGATCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTAGGTTGGCAAATAGCACTG
Primer_r	TTAAGACGAGGGGACGATCAC
PCR product length	218 bp
PCR conditions	95 °C15 sec62 °C60 sec35 cycles