KIAA1778

Product ID	ORK00914
Accession No	AF359381
Description	potassium channel tetramerization domain containing 12
Clone name	pg00707
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6216 bp) Predicted protein sequence (341 aa)
HaloTag ORF Clone	FHC00914
Flexi ORF Clone	FXC00914
Source	Human brain (hippocampus)
Rouge ID	mKIAA1778 by Kazusa Mouse cDNA Project

Length: 6216 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	4996 bp
Genome contig ID	gi51511729r_76252313
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AATTAAACACTAAAGAATAAAACATTCACTCCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTATTCCTCTTGGCTCCTTGGCATGGATTGGCTTGAACACTGGTCTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	76352313	76358526	1	99.0	Perfect prediction

Length: 341 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96CX2	3.5e-117	100.0	BTB/POZ domain-...	Homo sapiens
XP_001085454	5.9e-117	99.7	similar to pota...	Macaca mulatta
XP_344451	7.3e-117	97.0	similar to Pota...	Rattus norvegicus
XP_001076656	7.4e-117	97.0	similar to Pota...	Rattus norvegicus
XP_542614	9.4e-117	96.7	similar to Pota...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037738	2.1e-19	56.3	KIAA1317

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003131	52	145	PF02214	K+ channel tetramerisation
HMMSmart	IPR000210	50	153	SM00225	BTB/POZ-like

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-