Order Kazusa clone(s) from : ![]() |
Product ID | ORK01634 |
---|---|
Accession No | AB051517 |
Description | zyg-11 family member B, cell cycle regulator |
Clone name | pg01135 |
Vector information | |
cDNA sequence | DNA sequence (6404 bp) Predicted protein sequence (787 aa) |
HaloTag ORF Clone |
FHC01634
![]() |
Flexi ORF Clone | FXC01634 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1730
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4024 bp |
---|---|
Genome contig ID | gi89161185f_52864769 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (199146 - 199195) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 52964769 | 53063913 | 14 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GTTAGAGAAAGTGTCCCCATC |
---|---|
Primer_r | TTCTTGGTGACTTGCTATCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |