KIAA1735

Product ID	ORK00905
Accession No	AB051522
Description	DIX domain containing 1, transcript variant 2
Clone name	ph00512
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4732 bp) Predicted protein sequence (493 aa)
HaloTag ORF Clone	FHC00905
Flexi ORF Clone	FXC00905
Source	Human brain (hippocampus)
Rouge ID	mKIAA1735 by Kazusa Mouse cDNA Project

Length: 4732 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2943 bp
Genome contig ID	gi51511727f_111253336
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCTAGCCTAGGCTACAGAGCAGGACCCCATCTCC
Flanking genome sequence (144579 - 144628)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGTCATTTAAAAACTGAAGAATGTTCTCTTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	111353336	111397913	16	99.9	Perfect prediction

Length: 493 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH33034	3e-157	100.0	DIX domain cont...	Homo sapiens
BAF82496	4.3e-157	99.8	unnamed protein...	Homo sapiens
XP_001145139	3.9e-156	99.2	DIX domain cont...	Pan troglodytes
XP_001106878	1.1e-154	98.1	similar to DIX ...	Macaca mulatta
ABG25914	4.8e-154	98.7	DIX domain cont...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001158	411	486	PD003639	DIX
HMMPfam	IPR001158	408	490	PF00778	DIX
HMMSmart	IPR001158	408	490	SM00021	DIX
ProfileScan	IPR001158	410	490	PS50841	DIX

Primer_f	GCACAATAGAAACCATGGGGC
Primer_r	CTGACTGGTTGATGGTGCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-