Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04963 |
---|---|
Accession No | AB095940 |
Description | NUT family member 2A |
Clone name | ph01249 |
Vector information | |
cDNA sequence | DNA sequence (5858 bp) Predicted protein sequence (572 aa) |
Source | Human brain (hippocampus) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | f | 88975237 | 89120432 | 8 | 99.1 | Perfect prediction |
| 10 | f | 81453240 | 81604115 | 8 | 99.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 182 | GGVVCPPPLLLAAAPVVPVMAAQ | 204 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | GAAGTGGTGCAGGAGTATGTG |
---|---|
Primer_r | ATGAATGACGGCCTCCACCTT |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |