Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01179 |
---|---|
Accession No | AB051525 |
Description | testis expressed 2, transcript variant 2 |
Clone name | pj00192s1 |
Vector information | |
cDNA sequence | DNA sequence (4914 bp) Predicted protein sequence (1127 aa) |
HaloTag ORF Clone |
FHC01179
|
Flexi ORF Clone | FXC01179 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1738
by Kazusa Mouse cDNA Project
|
Note | We replaced pj00192, former representative clones for KIAA1738 with pj00192s1. (2001/2/07) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1530 bp |
---|---|
Genome contig ID | gi51511734r_59478531 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 59578531 | 59645309 | 11 | 99.7 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR002114 | 269 | 284 | PS00589 | Phosphotransferase system |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 469 | PELPVKTLGFFIMCVYVYLILPL | 491 | PRIMARY | 23 | 2 | 497 | GLFLGIGLGFMTAVCVIWFFTP | 518 | PRIMARY | 22 |
---|
Primer_f | GTGTGGACAAAGCTAATAGTG |
---|---|
Primer_r | GCCTACACAACGAAAAATCAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |