Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04779 |
---|---|
Accession No | AB051529 |
Description | dispatched homolog 2 (Drosophila) |
Clone name | pj01304s1 |
Vector information | |
cDNA sequence | DNA sequence (5035 bp) Predicted protein sequence (1301 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1742
by Kazusa Mouse cDNA Project
|
Note | We replaced pj01304, former representative clones for KIAA1742 with pj01304s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 737 bp |
---|---|
Genome contig ID | gi51511731f_38337773 |
PolyA signal sequence (AATAAA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (112777 - 112826) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | f | 38437726 | 38450548 | 8 | 98.9 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | IPR000731 | 407 | 543 | PS50156 | Sterol-sensing 5TM box |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 71 | AVLMLCLAVIFLCTLAGLLGARL | 93 | PRIMARY | 23 | 2 | 391 | YPLLALVAIFFGMALYLRSLFLT | 413 | PRIMARY | 23 | 3 | 418 | LGVLGSLLVAFFLYQVAFRMAYF | 440 | PRIMARY | 23 | 4 | 445 | LAALLLLSSVCANHTLIFFDLWR | 467 | PRIMARY | 23 | 5 | 485 | TMHHFGYLLLVSGLTTSAAFYAS | 507 | SECONDARY | 23 | 6 | 520 | LFMGTAVLVHLALTLVWLPASAV | 542 | PRIMARY | 23 | 7 | 860 | LSTEPAVVLGLALALAFATLLLG | 882 | PRIMARY | 23 | 8 | 886 | VPLSLFSVAAVAGTVLLTVGLLV | 908 | PRIMARY | 23 | 9 | 916 | TAEALFLSASVGLSVDFTVNYCI | 938 | SECONDARY | 23 | 10 | 961 | CATAVGAAALFAAGVLMLPATVL | 983 | PRIMARY | 23 | 11 | 992 | LMMVKCVSCGFASFFFQSLCCFF | 1014 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TACTGCATCTCCTATCACCTG |
---|---|
Primer_r | AAGAAACAGCAGAGAGATTGG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |