Gene/Protein Characteristic Table for KIAA1247
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00780
Accession No AB033073
Description sulfatase 2, transcript variant 1
Clone name pj01452
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4397 bp)
Predicted protein sequence (885 aa)
Flexi ORF Clone FXC00780
Source Human brain (hippocampus)
Rouge ID mKIAA1247 by Kazusa Mouse cDNA Project
Note We replaced hh03128a, former representative clones for KIAA1247 with pj01452. (2001/5/29)
Features of the cloned cDNA sequence
Description

Length: 4397 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1454 bp
Genome contig ID gi51511747r_45619063
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTTAACCTCCTTTACCCTTAACCCAACAGGGATTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAACTCTTTAGGCTCCAATTTTAAATAGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 20 r 45719063 45848215 21 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 885 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001106412 0 98.5 similar to sulf...
Macaca mulatta
BAG10010 0 100.0 extracellular s...
synthetic construct
Q8IWU5 0 99.9 Extracellular s...
Homo sapiens
AAQ88826 0 99.5 GPPS559 [Homo s...
Homo sapiens
EAW75691 0 97.8 sulfatase 2, is...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029000 1.4e-140 65.8 KIAA1077
AB023218 0.00024 21.4 KIAA1001
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000917 57 465 PF00884 Sulphatase
ScanRegExp IPR000917 101 113 PS00523 Sulphatase
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TAAGAAACAACAGAGGTGGAC
Primer_r CTGAAGTTATCTCTGCTCCTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 20
Experimental conditions
Panel name unigene
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp