KIAA1247

Product ID	ORK00780
Accession No	AB033073
Description	sulfatase 2, transcript variant 1
Clone name	pj01452
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4397 bp) Predicted protein sequence (885 aa)
HaloTag ORF Clone	FHC00780
Flexi ORF Clone	FXC00780
Source	Human brain (hippocampus)
Rouge ID	mKIAA1247 by Kazusa Mouse cDNA Project
Note	We replaced hh03128a, former representative clones for KIAA1247 with pj01452. (2001/5/29)

Length: 4397 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1454 bp
Genome contig ID	gi51511747r_45619063
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTAACCTCCTTTACCCTTAACCCAACAGGGATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAACTCTTTAGGCTCCAATTTTAAATAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	45719063	45848215	21	99.5	Perfect prediction

Length: 885 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001106412	98.5	similar to sulf...	Macaca mulatta
BAG10010	100.0	extracellular s...	synthetic construct
Q8IWU5	99.9	Extracellular s...	Homo sapiens
AAQ88826	99.5	GPPS559 [Homo s...	Homo sapiens
EAW75691	97.8	sulfatase 2, is...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029000	1.4e-140	65.8	KIAA1077
AB023218	0.00024	21.4	KIAA1001

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000917	57	465	PF00884	Sulphatase
ScanRegExp	IPR000917	101	113	PS00523	Sulphatase

Primer_f	TAAGAAACAACAGAGGTGGAC
Primer_r	CTGAAGTTATCTCTGCTCCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-