KIAA2037

Product ID	ORK05838
Accession No	AB111889
Description	lin-54 DREAM MuvB core complex component
Clone name	pj01545
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4506 bp) Predicted protein sequence (494 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA2037 by Kazusa Mouse cDNA Project

Length: 4506 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2553 bp
Genome contig ID	gi89161207r_83965725
PolyA signal sequence (CATAAA,-19)	+--------+--------+----*----+---- GCTCAGTTATTACTAACATAAATTGCTTTGAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAATATGTCTTCTCTTTTTTTCCCCACTGTTTCTTTTAAGAGCAGAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	84065725	84150998	13	99.4	Perfect prediction

Length: 494 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5RBN8	3e-163	100.0	Protein lin-54 ...	Pongo abelii
CAD97902	3.3e-163	100.0	hypothetical pr...	Homo sapiens
Q6MZP7	3.8e-163	100.0	Protein lin-54 ...	Homo sapiens
EAX05917	3.8e-163	100.0	hypothetical pr...	Homo sapiens
ACE86510	1.3e-162	99.8	lin-54 homolog ...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005172	265	305	PF03638	Tesmin/TSO1-like
HMMPfam	IPR005172	339	380	PF03638	Tesmin/TSO1-like

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-