KIAA1878

Gene/Protein Characteristic Table for KIAA1878

Order Kazusa clone(s) from :

Product ID	ORK05926
Accession No	AB058781
Description	microtubule-associated protein 6, transcript variant 2
Clone name	pj01649
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4328 bp) Predicted protein sequence (453 aa)
HaloTag ORF Clone	FHC05926
Flexi ORF Clone	FXC05926
Source	Human brain (hippocampus)
Rouge ID	mKIAA1878 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4328 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2943 bp
Genome contig ID	gi51511727r_74891554
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTCCAATTATAAATAAATGCTAAAGACGAACACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTCTTGATCTTATTTCCTTGGTGAGGCCCACCTGAGTAGGTGAAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	74991554	75057127	3	99.0	Perfect prediction

Features of the protein sequence

Description

Length: 453 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI50255	1e-124	100.0	Microtubule-ass...	Homo sapiens
NP_997460	1.7e-124	99.8	microtubule-ass...	Homo sapiens
Q96JE9	2.5e-124	99.8	Microtubule-ass...	Homo sapiens
XP_001175009	6.4e-123	98.9	microtubule-ass...	Pan troglodytes
XP_508647	9.7e-123	98.9	microtubule-ass...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007882	15	453	PF05217	STOP

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	TCACCCAAGGCTTTAGAGGAC
Primer_r	GGGATATAGAATGAGACTGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 11

Experimental conditions

Panel name	CCR
Primer_f	TCACCCAAGGCTTTAGAGGAC
Primer_r	GGGATATAGAATGAGACTGGC
PCR product length	95 bp
PCR conditions	15 °C64 sec60 °C30 sec193 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp