KIAA2038

Product ID	ORK00971
Accession No	AB124552
Description	GRB2 associated, regulator of MAPK1-like, transcript variant 1
Clone name	pj01991
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4142 bp) Predicted protein sequence (917 aa)
HaloTag ORF Clone	FHC00971
Flexi ORF Clone	FXC00971
Source	Human brain (hippocampus)

Length: 4142 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1387 bp
Genome contig ID	gi89161199f_26149527
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CCTCAAGGACTAATGAAATAAATGCTAGACTGCTG
Flanking genome sequence (116492 - 116541)	----+--------+--------+--------+--------+----* AAGATGAGTACAAGTGGCATTCTGGGTGCCAGCTGCTTTCTTCTTTTGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	26249464	26266017	6	99.2	Perfect prediction

Length: 917 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q75VX8	0	100.0	Protein FAM59B.	Homo sapiens
BAG10206	0	100.0	FAM59B protein ...	synthetic construct
XP_001086318	0	96.9	hypothetical pr...	Macaca mulatta
XP_343128	1.7e-167	87.3	hypothetical pr...	Rattus norvegicus
Q6PAJ3	5e-137	87.0	Protein FAM59B.	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	850	914	PF00536	Sterile alpha motif SAM

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-