KIAA1752

Gene/Protein Characteristic Table for KIAA1752

Order Kazusa clone(s) from :

Product ID	ORK05238
Accession No	AB051539
Description	fat mass and obesity associated
Clone name	pj02555
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4060 bp) Predicted protein sequence (507 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1752 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 4060 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2536 bp
Genome contig ID	gi51511732f_52195592
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AAATATTCATATCCAATAAACATATTAAAAGGATG
Flanking genome sequence (510276 - 510325)	----+--------+--------+--------+--------+----* AGATAAGAAACCGAGAGATTTTGCTGTTTTTTTCCTTTTGCATGGATGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	52295592	52705866	9	99.3	Perfect prediction

Features of the protein sequence

Description

Length: 507 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9C0B1	0	99.8	Protein fto; Fa...	Homo sapiens
BAG53322	0	99.6	unnamed protein...	Homo sapiens
XP_510968	0	99.4	fatso [Pan trog...	Pan troglodytes
Q5R7X0	0	98.4	Protein fto; Fa...	Pongo abelii
ACJ53748	6.1e-203	92.1	fat mass and ob...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CACATTAAGCAAAGCAGCCAG
Primer_r	ACTTTTAAACACCACGCCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 16

Experimental conditions

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp