KIAA1965

Product ID	ORK04278
Accession No	AB075845
Description	BMP binding endothelial regulator
Clone name	pj02601
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4299 bp) Predicted protein sequence (565 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1965 by Kazusa Mouse cDNA Project

Length: 4299 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2600 bp
Genome contig ID	gi89161213f_33872656
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AGATGACTTGAAATAAAAATGTTCTATGAATATTG
Flanking genome sequence (289355 - 289404)	----+--------+--------+--------+--------+----* AATTTGATGAGAAACAAGCACCCTCAATGAAGAACAAGCATAATTATGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	33972656	34162009	12	99.3	Perfect prediction

Length: 565 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8N8U9	100.0	BMP-binding end...	Homo sapiens
AAH60868	100.0	BMPER protein [...	Homo sapiens
XP_519036	99.6	hypothetical pr...	Pan troglodytes
XP_001105988	98.8	similar to BMP-...	Macaca mulatta
XP_532513	95.2	similar to BMP-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB111888	4.5e-20	33.7	KIAA2036
AB058677	0.00072	23.0	KIAA1781

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001007	46	104	PF00093	von Willebrand factor
	IPR001007	118	169	PF00093	von Willebrand factor
	IPR001007	181	237	PF00093	von Willebrand factor
	IPR001846	244	394	PF00094	von Willebrand factor
	IPR014853	433	505	PF08742	Domain of unknown function DUF1787
	IPR002919	509	562	PF01826	Protease inhibitor I8
HMMSmart	IPR001007	46	104	SM00214	von Willebrand factor
	IPR001007	118	169	SM00214	von Willebrand factor
	IPR001007	181	237	SM00214	von Willebrand factor
	IPR001846	235	393	SM00216	von Willebrand factor
ProfileScan	IPR001007	44	105	PS50184	von Willebrand factor
	IPR001007	179	238	PS50184	von Willebrand factor
	IPR001846	243	454	PS51233	von Willebrand factor
ScanRegExp	IPR001007	66	104	PS01208	von Willebrand factor
ScanRegExp	IPR001007	199	237	PS01208	von Willebrand factor

Primer_f	GGCTACCTCTTGAAAGTGACC
Primer_r	TCCATCTCCACCAATTAAGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-