Gene/Protein Characteristic Table for KIAA2036
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07687
Accession No AB111888
Description SCO-spondin
Clone name pf06513
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (7480 bp)
Predicted protein sequence (1322 aa)
Source Human brain (hippocampus)
Features of the cloned cDNA sequence
Description

Length: 7480 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 2399 bp
Genome contig ID gi89161213f_149014241
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ATGGGATACATTATAATTTCATTCTCAGTCTGGTT
Flanking genome sequence
(112864 - 112913)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGGCTGTCTTTGAATGCATCTCTTGCCAGAAAATG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 7 f 149114241 149127103 22 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 1322 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
A2VEC9 2.4e-188 89.2 SCO-spondin; Fl...
 Homo sapiens
EAW80030 3.6e-186 84.0 hCG16178, isofo...
 Homo sapiens
EAW80031 3.6e-186 84.0 hCG16178, isofo...
 Homo sapiens
XP_001096454 1.8e-180 83.9 similar to subc...
 Macaca mulatta
XP_001915998 2.6e-159 68.3 similar to SCO-...
 Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB011540 1.5e-10 37.1 KIAA0816
AB075845 2.4e-08 33.7 KIAA1965
AB011122 3.7e-05 29.4 KIAA0550
D63483 0.00023 26.5 KIAA0149
AB040878 0.00033 25.9 KIAA1445
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002172 273 294 PR00261 Low density lipoprotein-receptor
IPR002172 312 333 PR00261 Low density lipoprotein-receptor
IPR002172 348 369 PR00261 Low density lipoprotein-receptor
IPR002172 461 482 PR00261 Low density lipoprotein-receptor
IPR002172 500 521 PR00261 Low density lipoprotein-receptor
IPR002172 597 618 PR00261 Low density lipoprotein-receptor
HMMPfam IPR001846 13 49 PF00094 von Willebrand factor
IPR014853 84 158 PF08742 Domain of unknown function DUF1787
IPR002919 161 217 PF01826 Protease inhibitor I8
IPR002172 260 297 PF00057 Low density lipoprotein-receptor
IPR002172 300 338 PF00057 Low density lipoprotein-receptor
IPR002172 345 372 PF00057 Low density lipoprotein-receptor
IPR002172 376 414 PF00057 Low density lipoprotein-receptor
IPR002172 449 485 PF00057 Low density lipoprotein-receptor
IPR002172 487 526 PF00057 Low density lipoprotein-receptor
IPR002172 584 621 PF00057 Low density lipoprotein-receptor
IPR000884 706 755 PF00090 Thrombospondin
IPR000884 762 815 PF00090 Thrombospondin
IPR000884 921 972 PF00090 Thrombospondin
IPR001007 975 1032 PF00093 von Willebrand factor
IPR000421 1123 1176 PF00754 Coagulation factor 5/8 type
HMMSmart IPR002172 261 299 SM00192 Low density lipoprotein-receptor
IPR002172 301 335 SM00192 Low density lipoprotein-receptor
IPR002172 337 374 SM00192 Low density lipoprotein-receptor
IPR002172 377 416 SM00192 Low density lipoprotein-receptor
IPR002172 450 487 SM00192 Low density lipoprotein-receptor
IPR002172 488 528 SM00192 Low density lipoprotein-receptor
IPR002172 585 623 SM00192 Low density lipoprotein-receptor
IPR000884 705 756 SM00209 Thrombospondin
IPR000884 761 816 SM00209 Thrombospondin
IPR001007 878 919 SM00214 von Willebrand factor
IPR000884 920 973 SM00209 Thrombospondin
IPR001007 975 1032 SM00214 von Willebrand factor
ProfileScan IPR001846 1 105 PS51233 von Willebrand factor
IPR002172 261 298 PS50068 Low density lipoprotein-receptor
IPR002172 301 339 PS50068 Low density lipoprotein-receptor
IPR002172 337 373 PS50068 Low density lipoprotein-receptor
IPR002172 377 415 PS50068 Low density lipoprotein-receptor
IPR002172 450 486 PS50068 Low density lipoprotein-receptor
IPR002172 488 527 PS50068 Low density lipoprotein-receptor
IPR002172 585 622 PS50068 Low density lipoprotein-receptor
IPR000884 702 756 PS50092 Thrombospondin
IPR000884 758 816 PS50092 Thrombospondin
IPR000884 917 973 PS50092 Thrombospondin
IPR001007 973 1033 PS50184 von Willebrand factor
IPR000421 1073 1176 PS50022 Coagulation factor 5/8 type
ScanRegExp IPR002172 275 297 PS01209 Low density lipoprotein-receptor
IPR002172 314 338 PS01209 Low density lipoprotein-receptor
IPR002172 350 372 PS01209 Low density lipoprotein-receptor
IPR002172 390 414 PS01209 Low density lipoprotein-receptor
IPR002172 502 526 PS01209 Low density lipoprotein-receptor
IPR002172 599 621 PS01209 Low density lipoprotein-receptor
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp