Gene/Protein Characteristic Table for KIAA0816
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00133
Accession No AB011540
Description low density lipoprotein receptor-related protein 4
Clone name af09475
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (7966 bp)
Predicted protein sequence (1950 aa)
Flexi ORF Clone FXC00133
Source Human brain (amygdala)
Rouge ID mKIAA0816 by Kazusa Mouse cDNA Project
Note We replaced ha06338, former representative clones for KIAA0816 with af09475. (2005/08/06)
Features of the cloned cDNA sequence
Description

Length: 7966 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2111 bp
Genome contig ID gi51511727r_46734999
PolyA signal sequence
(TATAAA,-19)		 
+----*----+----*----+----*----+----
CTTTATGATAATTTAATATAAATTTAGCTTTTCTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AATCACCTTGCCTGGCTTGGAGTCATGACTAATCCTGCACCTGCTCTGTC

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 11 r 46834999 46896652 38 99.5 Perfect prediction
Features of the protein sequence
Description

Length: 1950 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE19679 0 100.0 low-density lip...
 Homo sapiens
XP_508403 0 99.3 low density lip...
 Pan troglodytes
BAG10387 0 100.0 low-density lip...
 synthetic construct
AAI36669 0 99.7 Low density lip...
 Homo sapiens
BAD83615 0 99.7 low density lip...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB111888 8.3e-18 37.1 KIAA2036
AB011539 3.5e-14 27.3 KIAA0815
AB053450 1.9e-10 27.0 KIAA1776
AB058676 3.5e-09 26.3 KIAA1780
AB058677 1.5e-07 25.0 KIAA1781
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002172 129 150 PR00261 Low density lipoprotein-receptor
IPR002172 168 189 PR00261 Low density lipoprotein-receptor
IPR002172 206 227 PR00261 Low density lipoprotein-receptor
IPR002172 249 270 PR00261 Low density lipoprotein-receptor
IPR002172 289 310 PR00261 Low density lipoprotein-receptor
IPR002172 328 349 PR00261 Low density lipoprotein-receptor
HMMPfam IPR002172 73 114 PF00057 Low density lipoprotein-receptor
IPR002172 117 153 PF00057 Low density lipoprotein-receptor
IPR002172 156 191 PF00057 Low density lipoprotein-receptor
IPR002172 194 230 PF00057 Low density lipoprotein-receptor
IPR002172 237 273 PF00057 Low density lipoprotein-receptor
IPR002172 277 313 PF00057 Low density lipoprotein-receptor
IPR002172 316 352 PF00057 Low density lipoprotein-receptor
IPR002172 358 397 PF00057 Low density lipoprotein-receptor
IPR006209 406 441 PF00008 EGF-like
IPR013091 443 481 PF07645 EGF calcium-binding
IPR000033 528 569 PF00058 Low-density lipoprotein receptor
IPR000033 571 612 PF00058 Low-density lipoprotein receptor
IPR000033 614 656 PF00058 Low-density lipoprotein receptor
IPR000033 658 699 PF00058 Low-density lipoprotein receptor
IPR000033 701 741 PF00058 Low-density lipoprotein receptor
IPR006209 750 784 PF00008 EGF-like
IPR000033 833 874 PF00058 Low-density lipoprotein receptor
IPR000033 876 917 PF00058 Low-density lipoprotein receptor
IPR000033 919 961 PF00058 Low-density lipoprotein receptor
IPR000033 963 1004 PF00058 Low-density lipoprotein receptor
IPR000033 1005 1045 PF00058 Low-density lipoprotein receptor
IPR006209 1054 1091 PF00008 EGF-like
IPR000033 1141 1182 PF00058 Low-density lipoprotein receptor
IPR000033 1184 1225 PF00058 Low-density lipoprotein receptor
IPR000033 1227 1269 PF00058 Low-density lipoprotein receptor
IPR000033 1271 1311 PF00058 Low-density lipoprotein receptor
IPR000033 1312 1353 PF00058 Low-density lipoprotein receptor
IPR006209 1361 1396 PF00008 EGF-like
IPR000033 1445 1486 PF00058 Low-density lipoprotein receptor
IPR000033 1488 1526 PF00058 Low-density lipoprotein receptor
IPR000033 1528 1570 PF00058 Low-density lipoprotein receptor
IPR000033 1572 1617 PF00058 Low-density lipoprotein receptor
HMMSmart IPR002172 74 116 SM00192 Low density lipoprotein-receptor
IPR002172 118 155 SM00192 Low density lipoprotein-receptor
IPR002172 157 193 SM00192 Low density lipoprotein-receptor
IPR002172 195 232 SM00192 Low density lipoprotein-receptor
IPR002172 238 275 SM00192 Low density lipoprotein-receptor
IPR002172 278 315 SM00192 Low density lipoprotein-receptor
IPR002172 317 354 SM00192 Low density lipoprotein-receptor
IPR006210 317 353 SM00181 EGF
IPR002172 359 399 SM00192 Low density lipoprotein-receptor
IPR006210 405 442 SM00181 EGF
IPR001881 443 482 SM00179 EGF-like calcium-binding
IPR006210 446 482 SM00181 EGF
IPR000033 508 550 SM00135 Low-density lipoprotein receptor
IPR000033 551 593 SM00135 Low-density lipoprotein receptor
IPR000033 594 637 SM00135 Low-density lipoprotein receptor
IPR000033 638 680 SM00135 Low-density lipoprotein receptor
IPR000033 681 722 SM00135 Low-density lipoprotein receptor
IPR001881 746 785 SM00179 EGF-like calcium-binding
IPR006210 749 785 SM00181 EGF
IPR000033 813 855 SM00135 Low-density lipoprotein receptor
IPR000033 856 898 SM00135 Low-density lipoprotein receptor
IPR000033 899 942 SM00135 Low-density lipoprotein receptor
IPR000033 943 985 SM00135 Low-density lipoprotein receptor
IPR000033 986 1027 SM00135 Low-density lipoprotein receptor
IPR006210 1053 1092 SM00181 EGF
IPR000033 1121 1163 SM00135 Low-density lipoprotein receptor
IPR000033 1164 1206 SM00135 Low-density lipoprotein receptor
IPR000033 1207 1250 SM00135 Low-density lipoprotein receptor
IPR000033 1251 1293 SM00135 Low-density lipoprotein receptor
IPR000033 1294 1333 SM00135 Low-density lipoprotein receptor
IPR001881 1357 1397 SM00179 EGF-like calcium-binding
IPR006210 1360 1397 SM00181 EGF
IPR000033 1425 1467 SM00135 Low-density lipoprotein receptor
IPR000033 1468 1510 SM00135 Low-density lipoprotein receptor
IPR000033 1511 1551 SM00135 Low-density lipoprotein receptor
IPR000033 1552 1594 SM00135 Low-density lipoprotein receptor
IPR000033 1595 1635 SM00135 Low-density lipoprotein receptor
IPR006210 1661 1694 SM00181 EGF
ProfileScan IPR002172 74 115 PS50068 Low density lipoprotein-receptor
IPR002172 118 154 PS50068 Low density lipoprotein-receptor
IPR002172 157 192 PS50068 Low density lipoprotein-receptor
IPR002172 195 231 PS50068 Low density lipoprotein-receptor
IPR002172 238 274 PS50068 Low density lipoprotein-receptor
IPR002172 278 314 PS50068 Low density lipoprotein-receptor
IPR002172 317 353 PS50068 Low density lipoprotein-receptor
IPR002172 359 398 PS50068 Low density lipoprotein-receptor
IPR000033 528 570 PS51120 Low-density lipoprotein receptor
IPR000033 571 613 PS51120 Low-density lipoprotein receptor
IPR000033 614 657 PS51120 Low-density lipoprotein receptor
IPR000033 658 700 PS51120 Low-density lipoprotein receptor
IPR000033 701 741 PS51120 Low-density lipoprotein receptor
IPR000033 833 875 PS51120 Low-density lipoprotein receptor
IPR000033 876 918 PS51120 Low-density lipoprotein receptor
IPR000033 919 962 PS51120 Low-density lipoprotein receptor
IPR000033 963 1005 PS51120 Low-density lipoprotein receptor
IPR000033 1006 1046 PS51120 Low-density lipoprotein receptor
IPR000033 1141 1183 PS51120 Low-density lipoprotein receptor
IPR000033 1184 1226 PS51120 Low-density lipoprotein receptor
IPR000033 1227 1270 PS51120 Low-density lipoprotein receptor
IPR000033 1271 1312 PS51120 Low-density lipoprotein receptor
IPR000033 1313 1354 PS51120 Low-density lipoprotein receptor
IPR000033 1445 1487 PS51120 Low-density lipoprotein receptor
IPR000033 1488 1518 PS51120 Low-density lipoprotein receptor
IPR000033 1528 1571 PS51120 Low-density lipoprotein receptor
IPR000033 1572 1613 PS51120 Low-density lipoprotein receptor
IPR000033 1614 1655 PS51120 Low-density lipoprotein receptor
ScanRegExp IPR002172 92 114 PS01209 Low density lipoprotein-receptor
IPR002172 131 153 PS01209 Low density lipoprotein-receptor
IPR002172 170 191 PS01209 Low density lipoprotein-receptor
IPR002172 208 230 PS01209 Low density lipoprotein-receptor
IPR002172 251 273 PS01209 Low density lipoprotein-receptor
IPR002172 291 313 PS01209 Low density lipoprotein-receptor
IPR002172 330 352 PS01209 Low density lipoprotein-receptor
IPR002172 372 397 PS01209 Low density lipoprotein-receptor
IPR013032 426 441 PS01186 EGF-like region
IPR001881 443 466 PS01187 EGF-like calcium-binding
IPR000152 457 468 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 466 481 PS01186 EGF-like region
IPR013032 770 784 PS01186 EGF-like region

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 1770 SYAIGGLLSILLILVVIAALMLY 1792 PRIMARY 23
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 11
Experimental conditions
Panel name nakayama
Primer_f GAAAGTCCAATCTCTCCAGTG
Primer_r AAGAGCAAGTAGAAAAGTGGC
PCR product length 224 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp