Gene/Protein Characteristic Table for FLJ00141
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05092
Accession No AK074070
Clone name sh04092s1
Vector information
cDNA sequence DNA sequence (5241 bp)
Predicted protein sequence (1326 aa)
Flexi ORF Clone FXC05092
Source Human spleen
Features of the cloned cDNA sequence
Description

Length: 5241 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1202 bp
Genome contig ID gi51511727f_117883568
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GCATTTCAGCAGAACAATAAAGCCTTTGGACTACG
Flanking genome sequence
(150379 - 150428)
----+----*----+----*----+----*----+----*----+----*
GAAGTGAGTGGAAGGCCGGTGTGGGGCTTGGCGCTGAGGCACTTGGGGAT
Features of the protein sequence
Description

Length: 1326 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB84896 0 100.0 FLJ00141 protei...
Homo sapiens
EAW67402 0 99.7 pleckstrin homo...
Homo sapiens
XP_001162786 0 99.4 pleckstrin homo...
Pan troglodytes
XP_001162312 0 98.6 pleckstrin homo...
Pan troglodytes
XP_001162125 0 99.3 pleckstrin homo...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against other entries from Kazusa human cDNA project (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014538 5.2e-124 95.5 KIAA0638
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000253 71 132 PF00498 Forkhead-associated
IPR001849 1217 1319 PF00169 Pleckstrin-like
HMMSmart IPR001849 1217 1321 SM00233 Pleckstrin-like
ProfileScan IPR001849 1216 1319 PS50003 Pleckstrin-like
Experimental conditions
Primer_f
Primer_r
PCR conditions test
Order Kazusa clone(s) from : Japan || Other countries
Back to the NEDO Protein Database homepage
Send a message to office AT kazusa.or.jp