KIAA0370

Product ID	ORK07379
Accession No	AB002368
Description	exportin 6
Clone name	sj06874
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4422 bp) Predicted protein sequence (1132 aa)
Source
Rouge ID	mKIAA0370 by Kazusa Mouse cDNA Project
Note	We replaced hh00184 and hh00184s1, former representative clones for KIAA0370 with sj06874. (2002/5/10,2005/08/06)

Length: 4422 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	543 bp
Genome contig ID	gi51511732r_27916817
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- AAACTAAGAAGCTTAATGAAAAGAAATAAAATGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATGTTGTTGTTCTAGAAACCCTGGCTGGGGAGCTGCTTGCTACTCACAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	28016817	28130691	24	100.0	Perfect prediction

Length: 1132 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96QU8	100.0	Exportin-6; Sho...	Homo sapiens
XP_001138416	99.9	exportin 6 isof...	Pan troglodytes
AAI44190	99.8	XPO6 protein [H...	Homo sapiens
EAW55736	100.0	exportin 6, iso...	Homo sapiens
XP_001137656	99.3	exportin 6 isof...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001494	38	104	PF03810	Importin-beta
HMMPfam	IPR013598	110	260	PF08389	Exportin-1/Importin-beta-like
ProfileScan	IPR001494	38	104	PS50166	Importin-beta

Primer_f	CGTCACATCTCTCCTTGGCTG
Primer_r	ACTAGGAGGCACCAGGAAATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CGTCACATCTCTCCTTGGCTG
Primer_r	ACTAGGAGGCACCAGGAAATC
PCR product length	133 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles