HUGE |
Gene/Protein Characteristic Table for KIAA0001 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06258 |
---|---|
Accession No. : | D13626 |
Description : | P2Y purinoceptor 14. |
HUGO Gene Name : | purinergic receptor P2Y, G-protein coupled, 14 (P2RY14) |
Clone Name : | ha00008 [Vector Info] |
Flexi ORF Clone : | pF1KA0001
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2416 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1183 bp Genome contig ID gi89161205r_152312595 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TGTCTATATACTAATAAAGAAATGTTTTAATACTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TCTATTTTTTCTTAATAATCAACATATGAGGAAACATTACCAGATTTCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 152412595 152478849 3 98.9 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 347 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 3 |
: Genebridge 4 | |
: ACAACTCACTCAGGCATCTT | |
: AAACAGCTCTCTAGCCCTTC | |
: 123 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |