HUGE

Gene/Protein Characteristic Table for KIAA0007

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00362
Accession No. :	D26488
Description :	WD repeat protein 43.
HUGO Gene Name :	WD repeat domain 43 (WDR43)
Clone Name :	ha02056 [Vector Info]
Flexi ORF Clone :	pF1KSDA0007
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3500 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1437 bp

Genome contig ID gi89161199f_28871040
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTCTTTGTAAAGTGAATAAATATTCATCTTTTCCC
Flanking genome sequence
(153550 - 153599)
----+----*----+----*----+----*----+----*----+----*
AGTGCTTGTCTTGTGGTATATGTAGAGGAATACAGCCACATGTTTGGGCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 28971040 29024588 18 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 686 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515377	99.7	WD repeat domai...	Pan troglodytes
Q15061	100.0	WD repeat-conta...	Homo sapiens
XP_001092386	98.7	WD repeat domai...	Macaca mulatta
XP_532920	92.3	similar to WD-r...	Canis lupus fam...
XP_583609	91.5	WD repeat domai...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001680 28 51 PF00400 WD40 repeat

IPR001680 125 163 PF00400 WD40 repeat

IPR001680 167 203 PF00400 WD40 repeat

IPR012979 499 585 PF08162 Protein of unknown function NUC189

HMMSmart IPR001680 15 51 SM00320 WD40 repeat

IPR001680 54 119 SM00320 WD40 repeat

IPR001680 122 163 SM00320 WD40 repeat

IPR001680 166 203 SM00320 WD40 repeat

IPR001680 206 259 SM00320 WD40 repeat

ProfileScan IPR001680 131 166 PS50082 WD40 repeat

IPR001680 131 268 PS50294 WD40 repeat

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	28	51	PF00400	WD40 repeat
IPR001680	125	163	PF00400	WD40 repeat
IPR001680	167	203	PF00400	WD40 repeat
IPR012979	499	585	PF08162	Protein of unknown function NUC189
HMMSmart	IPR001680	15	51	SM00320	WD40 repeat
IPR001680	54	119	SM00320	WD40 repeat
IPR001680	122	163	SM00320	WD40 repeat
IPR001680	166	203	SM00320	WD40 repeat
IPR001680	206	259	SM00320	WD40 repeat
ProfileScan	IPR001680	131	166	PS50082	WD40 repeat
IPR001680	131	268	PS50294	WD40 repeat

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 102 QTDLLALGTAVGSILLYSTVKGE 124 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	102	QTDLLALGTAVGSILLYSTVKGE	124	PRIMARY	23

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GAGCCGATATTGGCTTAGTG
Primer_r	: GGTTCAAACTTGCTTTCCCA
PCR product length	: 240 bp
PCR conditions	: 95 °C15 sec58 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1437 bp
Genome contig ID	gi89161199f_28871040
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTCTTTGTAAAGTGAATAAATATTCATCTTTTCCC
Flanking genome sequence (153550 - 153599)	----+--------+--------+--------+--------+----* AGTGCTTGTCTTGTGGTATATGTAGAGGAATACAGCCACATGTTTGGGCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	28971040	29024588	18	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0007

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information