HUGE

Gene/Protein Characteristic Table for KIAA0009

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06049
Accession No. :	D13634
Description :	Mitochondrial fission regulator 1.
HUGO Gene Name :	mitochondrial fission regulator 1 (MTFR1)
Clone Name :	ha00176 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2480 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1518 bp

Genome contig ID gi51511724f_66657141
PolyA signal sequence
(AATAAA,-33)
+----*----+----*----+----*----+----
AAAATAAAGCAAACTAACTGTTTTATTTTCCTTGG
Flanking genome sequence
(128211 - 128260)
----+----*----+----*----+----*----+----*----+----*
ACCATAGTGCTTCCATTTTTTCTTTTTTCACAATAGGTAAGATTCTTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 66744782 66785350 7 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 319 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15390	5.8e-104	100.0	Mitochondrial f...	Homo sapiens
AAH36116	1.5e-103	99.7	Mitochondrial f...	Homo sapiens
Q5RFN3	2.7e-101	97.5	Mitochondrial f...	Pongo abelii
XP_001099893	7.1e-97	95.8	chondrocyte pro...	Macaca mulatta
BAG65480	3.8e-96	98.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007972 6 237 PF05308 Protein of unknown function DUF729

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007972	6	237	PF05308	Protein of unknown function DUF729

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GGGAGTATTAGGAGATGGGA
Primer_r	: CAGGTGAATGAGAGGTGAAC
PCR product length	: 176 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1518 bp
Genome contig ID	gi51511724f_66657141
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- AAAATAAAGCAAACTAACTGTTTTATTTTCCTTGG
Flanking genome sequence (128211 - 128260)	----+--------+--------+--------+--------+----* ACCATAGTGCTTCCATTTTTTCTTTTTTCACAATAGGTAAGATTCTTTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	66744782	66785350	7	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0009

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information