HUGE

Gene/Protein Characteristic Table for KIAA0026

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00372
Accession No. :	D14812
Description :	Mortality factor 4-like protein 2.
HUGO Gene Name :	mortality factor 4 like 2 (MORF4L2)
Clone Name :	ha00640 [Vector Info]
Flexi ORF Clone :	pF1KSDA0026
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1826 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 654 bp

Genome contig ID gi89161218r_102717089
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTCAGATCTTAAATAAAATTTGTTTCTAAATTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCAAGTAATTTGTAGTGTGCCTTTCATGTTACTGGTTGGTATTCTGG

Features of the protein sequence	Description

Length: 288 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAH91151	1.2e-103	99.7	hypothetical pr...	Pongo abelii
BAG54326	1.4e-103	99.7	unnamed protein...	Homo sapiens
Q4R578	2.7e-103	99.7	Mortality facto...	Macaca fascicularis
BAD97224	2.7e-103	99.7	MORF-related ge...	Homo sapiens
XP_538122	1.6e-102	98.6	similar to Mort...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008676 15 276 PF05712 MRG

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008676	15	276	PF05712	MRG

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CCTCCTCAGGAAAGAAGACA
Primer_r	: GCTGAGGTGCTTCGCTGGTA
PCR product length	: 180 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	654 bp
Genome contig ID	gi89161218r_102717089
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTCAGATCTTAAATAAAATTTGTTTCTAAATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCAAGTAATTTGTAGTGTGCCTTTCATGTTACTGGTTGGTATTCTGG

Gene/Protein Characteristic Table for KIAA0026

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information