HUGE

Gene/Protein Characteristic Table for KIAA0030

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01953
Accession No. :	D21063
Description :	DNA replication licensing factor MCM2.
HUGO Gene Name :	minichromosome maintenance complex component 2 (MCM2)
Clone Name :	ha01140 [Vector Info]
Flexi ORF Clone :	pF1KA0030
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3406 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 660 bp

Genome contig ID gi89161205f_128700850
PolyA signal sequence
(AATAAA,-10)
+----*----+----*----+----*----+----
GTAGTTTTAATTTTTAATAAAGTTGAATAAAATAT
Flanking genome sequence
(123118 - 123167)
----+----*----+----*----+----*----+----*----+----*
AAACGCTGGTATCTGTTGGCTTCCATTCCGCTTTAGTAAGTAACCTGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 128799969 128823966 16 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 914 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P49736	100.0	DNA replication...	Homo sapiens
AAH06165	99.9	Minichromosome ...	Homo sapiens
AAH17258	99.9	Minichromosome ...	Homo sapiens
XP_001136645	99.9	minichromosome ...	Pan troglodytes
AAP88736	100.0	MCM2 minichromo...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001208 465 516 PD001041 MCM

FPrintScan IPR008045 313 330 PR01658 MCM protein 2

IPR008045 336 348 PR01658 MCM protein 2

IPR008045 371 385 PR01658 MCM protein 2

IPR008045 432 443 PR01658 MCM protein 2

IPR008045 447 458 PR01658 MCM protein 2

IPR001208 524 539 PR01657 MCM

IPR001208 584 598 PR01657 MCM

IPR001208 612 625 PR01657 MCM

IPR001208 636 648 PR01657 MCM

IPR001208 663 671 PR01657 MCM

HMMPfam IPR001208 470 813 PF00493 MCM

HMMSmart IPR001208 300 813 SM00350 MCM

ProfileScan IPR001208 483 689 PS50051 MCM

ScanRegExp IPR001208 592 600 PS00847 MCM

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001208	465	516	PD001041	MCM
FPrintScan	IPR008045	313	330	PR01658	MCM protein 2
IPR008045	336	348	PR01658	MCM protein 2
IPR008045	371	385	PR01658	MCM protein 2
IPR008045	432	443	PR01658	MCM protein 2
IPR008045	447	458	PR01658	MCM protein 2
IPR001208	524	539	PR01657	MCM
IPR001208	584	598	PR01657	MCM
IPR001208	612	625	PR01657	MCM
IPR001208	636	648	PR01657	MCM
IPR001208	663	671	PR01657	MCM
HMMPfam	IPR001208	470	813	PF00493	MCM
HMMSmart	IPR001208	300	813	SM00350	MCM
ProfileScan	IPR001208	483	689	PS50051	MCM
ScanRegExp	IPR001208	592	600	PS00847	MCM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TGGCATGGAAAGGGACTA
Primer_r	: CAATCATCTCCTCGTCCT
PCR product length	: 280 bp
PCR conditions	: 95 °C15 sec54 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	660 bp
Genome contig ID	gi89161205f_128700850
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- GTAGTTTTAATTTTTAATAAAGTTGAATAAAATAT
Flanking genome sequence (123118 - 123167)	----+--------+--------+--------+--------+----* AAACGCTGGTATCTGTTGGCTTCCATTCCGCTTTAGTAAGTAACCTGGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	128799969	128823966	16	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA0030

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information