HUGE

Gene/Protein Characteristic Table for KIAA0031

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00375
Accession No. :	D21163
Description :	116 kDa U5 small nuclear ribonucleoprotein component.
HUGO Gene Name :
Clone Name :	ha01047 [Vector Info]
Flexi ORF Clone :	pF1KSDA0031
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3784 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 805 bp

Genome contig ID gi51511734r_40183363
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCCCCAGTGAAAAAGAGTCTGTTGATTTTCCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACTGCTTTATTAGGAATGTACCAGGGATTGAGTTAGGGGAGTTGGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 40283363 40332318 28 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 977 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15029	100.0	116 kDa U5 smal...	Homo sapiens
XP_548058	99.9	similar to 116 ...	Canis lupus fam...
Q5R6E0	99.8	116 kDa U5 smal...	Pongo abelii
BAF85797	99.8	unnamed protein...	Homo sapiens
AAH02360	99.9	Elongation fact...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000795 136 149 PR00315 Protein synthesis factor

IPR000795 181 189 PR00315 Protein synthesis factor

IPR000795 206 216 PR00315 Protein synthesis factor

IPR000795 222 233 PR00315 Protein synthesis factor

IPR000795 258 267 PR00315 Protein synthesis factor

HMMPfam IPR000795 132 447 PF00009 Protein synthesis factor

IPR004161 494 571 PF03144 Translation elongation factor EFTu/EF1A

IPR005517 710 829 PF03764 Translation elongation factor EFG/EF2

IPR000640 831 920 PF00679 Translation elongation factor EFG/EF2

HMMTigr IPR005225 132 306 TIGR00231 Small GTP-binding protein domain

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000795	136	149	PR00315	Protein synthesis factor
IPR000795	181	189	PR00315	Protein synthesis factor
IPR000795	206	216	PR00315	Protein synthesis factor
IPR000795	222	233	PR00315	Protein synthesis factor
IPR000795	258	267	PR00315	Protein synthesis factor
HMMPfam	IPR000795	132	447	PF00009	Protein synthesis factor
IPR004161	494	571	PF03144	Translation elongation factor EFTu/EF1A
IPR005517	710	829	PF03764	Translation elongation factor EFG/EF2
IPR000640	831	920	PF00679	Translation elongation factor EFG/EF2
HMMTigr	IPR005225	132	306	TIGR00231	Small GTP-binding protein domain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CAACTCACCAACCTCCAACC
Primer_r	: GTTTCATCCCCTTCTCTTTC
PCR product length	: 138 bp
PCR conditions	: 95 °C15 sec58 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	805 bp
Genome contig ID	gi51511734r_40183363
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCCCCAGTGAAAAAGAGTCTGTTGATTTTCCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTGCTTTATTAGGAATGTACCAGGGATTGAGTTAGGGGAGTTGGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	40283363	40332318	28	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0031

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information