HUGE

Gene/Protein Characteristic Table for KIAA0035

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00378
Accession No. :	D21262
Description :	Nucleolar phosphoprotein p130.
HUGO Gene Name :	nucleolar and coiled-body phosphoprotein 1 (NOLC1)
Clone Name :	ha01976 [Vector Info]
Flexi ORF Clone :	pF1KSDA0035
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3727 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1601 bp

Genome contig ID gi89161187f_103802166
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ACTACAAAATAATAAACTGGCTGGTTTATAATGTG
Flanking genome sequence
(111453 - 111502)
----+----*----+----*----+----*----+----*----+----*
TCTTGGGAGTTTTATTATTGTGAGTCTAAACCCCTCCCACCCCCTACTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 103902162 103913617 13 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 707 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAA04803	2.1e-161	100.0	ORF [Homo sapiens].	Homo sapiens
BAG09575	2.1e-161	100.0	nucleolar phosp...	synthetic construct
EAW49716	8.3e-161	99.9	nucleolar and c...	Homo sapiens
XP_001170994	4.9e-158	98.3	similar to NOLC...	Pan troglodytes
XP_001112123	3.6e-150	94.1	similar to Nucl...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom NULL 630 707 PD015362 NULL

HMMPfam IPR007718 609 704 PF05022 SRP40

ProfileScan IPR006594 8 40 PS50896 LisH dimerisation motif

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	630	707	PD015362	NULL
HMMPfam	IPR007718	609	704	PF05022	SRP40
ProfileScan	IPR006594	8	40	PS50896	LisH dimerisation motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GCCTTCATGGACGAGTTA
Primer_r	: CTTTTACCATGCAGACTG
PCR product length	: 161 bp
PCR conditions	: 95 °C15 sec52 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1601 bp
Genome contig ID	gi89161187f_103802166
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ACTACAAAATAATAAACTGGCTGGTTTATAATGTG
Flanking genome sequence (111453 - 111502)	----+--------+--------+--------+--------+----* TCTTGGGAGTTTTATTATTGTGAGTCTAAACCCCTCCCACCCCCTACTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	103902162	103913617	13	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0035

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information