| HUGE |
Gene/Protein Characteristic Table for KIAA0039 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00381 |
|---|---|
| Accession No. : | D26018 |
| Description : | DNA polymerase subunit delta 3. |
| HUGO Gene Name : | polymerase (DNA-directed), delta 3, accessory subunit (POLD3) |
| Clone Name : | ha02030 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0039
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3430 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1954 bp Genome contig ID gi51511727f_73881277 PolyA signal sequence
(AATAAA,-22)
ACCACATGAGTTAAATAAATTTGAGAAGTTGTTTTFlanking genome sequence
(150138 - 150187)
AAAACAGTGCTTCAAACTGAGTATCTGATGAGTCTCTTATTTGATGGATG
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 f 73981277 74031413 12 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 491 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Motif_DB | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| None | - | - | - | - | - |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 11 |
| : Genebridge 4 | |
| : TTGGGATTGTGCTGACTTTGG | |
| : GACAAATGACCAGAGGCAATG | |
| : 288 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
