HUGE

Gene/Protein Characteristic Table for KIAA0049

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00385
Accession No. :	D30756
Description :
HUGO Gene Name :	neighbor of BRCA1 gene 1 (NBR1)
Clone Name :	ha01035 [Vector Info]
Flexi ORF Clone :	pF1KSDA0049
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4654 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1613 bp

Genome contig ID gi51511734f_38476024
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTAAGAATGGTGAAATAAATGTTCTTGGAAATTCC
Flanking genome sequence
(243209 - 243258)
----+----*----+----*----+----*----+----*----+----*
TACCCGGACTGGCTAGTCCTTGCGGAAGCAGCGTCCGGGCCCTCGGGTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 38576024 38719231 21 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 969 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAS15047	100.0	migration-induc...	Homo sapiens
Q14596	99.9	Next to BRCA1 g...	Homo sapiens
BAF82694	99.8	unnamed protein...	Homo sapiens
XP_001155667	99.2	neighbor of BRC...	Pan troglodytes
XP_001155005	99.2	neighbor of BRC...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000270 7 88 PF00564 Octicosapeptide/Phox/Bem1p

IPR000433 214 257 PF00569 Zinc finger

IPR000449 919 959 PF00627 Ubiquitin-associated/Translation elongation factor EF1B

HMMSmart IPR000270 7 88 SM00666 Octicosapeptide/Phox/Bem1p

IPR000433 214 259 SM00291 Zinc finger

ProfileScan IPR000433 214 260 PS50135 Zinc finger

IPR000449 916 960 PS50030 Ubiquitin-associated/Translation elongation factor EF1B

ScanRegExp IPR000433 220 246 PS01357 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000270	7	88	PF00564	Octicosapeptide/Phox/Bem1p
IPR000433	214	257	PF00569	Zinc finger
IPR000449	919	959	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR000270	7	88	SM00666	Octicosapeptide/Phox/Bem1p
IPR000433	214	259	SM00291	Zinc finger
ProfileScan	IPR000433	214	260	PS50135	Zinc finger
IPR000449	916	960	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR000433	220	246	PS01357	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CGAAGAGAGCCCTGATAACAT
Primer_r	: TGCTGTCCCTTCTGTCTGCTC
PCR product length	: 145 (0.9k) bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1613 bp
Genome contig ID	gi51511734f_38476024
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTAAGAATGGTGAAATAAATGTTCTTGGAAATTCC
Flanking genome sequence (243209 - 243258)	----+--------+--------+--------+--------+----* TACCCGGACTGGCTAGTCCTTGCGGAAGCAGCGTCCGGGCCCTCGGGTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	38576024	38719231	21	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0049

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information