HUGE |
Gene/Protein Characteristic Table for KIAA0052 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | D29641 |
Description : | Superkiller viralicidic activity 2-like 2. |
HUGO Gene Name : | |
Clone Name : | ha01319 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3353 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 211 bp Genome contig ID gi51511721f_54539587 PolyA signal sequence
(AATAAA,-28) +----*----+----*----+----*----+----
TTTTTTTAATAAAAATGTATACAGGTGGGGCACTGFlanking genome sequence
(216983 - 217032) ----+----*----+----*----+----*----+----*----+----*
TTTTGGTGGAAGGCTTGGAGTTTTTTTAATGAGTTTAGAGCTATTAGATA
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 54639587 54756568 27 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1046 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 5 |
: Genebridge 4 | |
: ACGGCATCCCCTTATTAGACC | |
: CCACTCGTCCTTTCATCTCTA | |
: 316 (3.5k) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |