HUGE

Gene/Protein Characteristic Table for KIAA0054

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07717
Accession No. :	D29677
Description :	Probable helicase with zinc finger domain.
HUGO Gene Name :	helicase with zinc finger (HELZ)
Clone Name :	ha00503s1 [Vector Info]
Flexi ORF Clone :	pF1KA0054
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha00503, former representative clones for KIAA0054 with ha00503s1. (2008/8/27)

Features of the cloned DNA sequence	Description

Length: 6274 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 300 bp

Genome contig ID gi51511734r_62404529
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAAGCTAGCAGCCAAGAGGTTAATTGTGCAACTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGAAAAGTTTGTCTAAAATGTATTTAAAAAGAAA

Features of the protein sequence	Description

Length: 1943 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW89023	100.0	helicase with z...	Homo sapiens
AAI30583	99.9	Helicase with z...	Homo sapiens
P42694	99.9	Probable helica...	Homo sapiens
AAI44084	99.9	HELZ protein [H...	Homo sapiens
XP_001163943	99.7	helicase with z...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051556	3e-15	40.7	KIAA1769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000571 180 206 PF00642 Zinc finger

IPR009818 1096 1113 PF07145 Ataxin-2

HMMSmart IPR000571 179 206 SM00356 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	180	206	PF00642	Zinc finger
IPR009818	1096	1113	PF07145	Ataxin-2
HMMSmart	IPR000571	179	206	SM00356	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TAACAAGCAGATCGCGGA
Primer_r	: GGTCGCTACTCTTCTTGG
PCR product length	: 143 bp
PCR conditions	: 95 °C15 sec56 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	300 bp
Genome contig ID	gi51511734r_62404529
PolyA signal sequence (None)	+--------+--------+----*----+---- CAAGCTAGCAGCCAAGAGGTTAATTGTGCAACTAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGAAAAGTTTGTCTAAAATGTATTTAAAAAGAAA

Gene/Protein Characteristic Table for KIAA0054

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information