HUGE |
Gene/Protein Characteristic Table for KIAA1769 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01636 |
---|---|
Accession No. : | AB051556 |
Description : | Peroxisomal proliferator-activated receptor A-interacting complex 285 kDa protein. |
HUGO Gene Name : | |
Clone Name : | af00171 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1769
![]() |
Source : | Human brain (amygdala) |
Note : | We replaced pj00758, former representative clones for KIAA1769 with af00171. (2001/5/29) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7484 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1137 bp Genome contig ID gi51511747r_61559908 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTTTGAATTATGTGATTAGATATTAATTTAATGATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAACCACTCTGAAAGCTCTTCTCACTTCTGGGTGTTTGAGGTCTGGCTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 r 61659908 61669551 14 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2114 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AATGAGCGGCTGCAAAACCTG | |
: GTCTTCAGCTTGCTCTTGTAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: CCR | |
: AATGAGCGGCTGCAAAACCTG | |
: GTCTTCAGCTTGCTCTTGTAG | |
: 146(250) bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |