HUGE

Gene/Protein Characteristic Table for KIAA1008

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01142
Accession No. :	AB023225
Description :	Exosome complex exonuclease RRP44.
HUGO Gene Name :
Clone Name :	hh04776s1 [Vector Info]
Flexi ORF Clone :	pF1KA1008
Source :	Human adult brain
Note :	We replaced hh04776, former representative clones for KIAA1008 with hh04776s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5231 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2351 bp

Genome contig ID gi51511729r_72129866
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTTCAGCCTGGATGATGAGAGTGAGACTCCATCGC
Flanking genome sequence
(99716 - 99667)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGAAAAGAAAATTAGCCAGGTGTGGTGGCAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 13 r 72229582 72254064 21 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 935 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11273	100.0	exosome complex...	synthetic construct
AAH56143	95.0	DIS3 mitotic co...	Homo sapiens
BAF92610	94.9	DIS3 [Homo sapi...	Homo sapiens
CAH56266	94.7	hypothetical pr...	Homo sapiens
XP_001495267	90.1	DIS3 mitotic co...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075835	1.5e-48	37.2	KIAA1955
AB051556	1.4e-12	24.0	KIAA1769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001900 444 774 PF00773 Ribonuclease II and R

ScanRegExp IPR001900 741 765 PS01175 Ribonuclease II and R

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001900	444	774	PF00773	Ribonuclease II and R
ScanRegExp	IPR001900	741	765	PS01175	Ribonuclease II and R

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTTCCCTTGCTAATCACAGAG

Primer_r
: TGGAACCTGGCACAACGTAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2351 bp
Genome contig ID	gi51511729r_72129866
PolyA signal sequence (None)	+--------+--------+----*----+---- GTTCAGCCTGGATGATGAGAGTGAGACTCCATCGC
Flanking genome sequence (99716 - 99667)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGAAAAGAAAATTAGCCAGGTGTGGTGGCAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	13	r	72229582	72254064	21	99.5	Perfect prediction

Primer_f	: CTTCCCTTGCTAATCACAGAG
Primer_r	: TGGAACCTGGCACAACGTAAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1008

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information