HUGE |
Gene/Protein Characteristic Table for KIAA1008 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01142 |
---|---|
Accession No. : | AB023225 |
Description : | Exosome complex exonuclease RRP44. |
HUGO Gene Name : | |
Clone Name : | hh04776s1 [Vector Info] |
Flexi ORF Clone : | pF1KA1008 |
Source : | Human adult brain |
Note : | We replaced hh04776, former representative clones for KIAA1008 with hh04776s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5231 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2351 bp Genome contig ID gi51511729r_72129866 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GTTCAGCCTGGATGATGAGAGTGAGACTCCATCGCFlanking genome sequence
(99716 - 99667) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGAAAAGAAAATTAGCCAGGTGTGGTGGCAAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 r 72229582 72254064 21 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 935 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CTTCCCTTGCTAATCACAGAG | |
: TGGAACCTGGCACAACGTAAG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 13 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |