HUGE

Gene/Protein Characteristic Table for KIAA0083

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00400
Accession No. :	D42046
Description :	DNA2-like helicase.
HUGO Gene Name :	DNA replication helicase 2 homolog (yeast) (DNA2)
Clone Name :	ha03631 [Vector Info]
Flexi ORF Clone :	pF1KSDA0083
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 4207 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 973 bp

Genome contig ID gi89161187r_69743883
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAGTTTTTTATTTAATAAATTTTTTCTACTAATGG
Flanking genome sequence
(99945 - 99896)
----+----*----+----*----+----*----+----*----+----*
ATCTTAACTGTGTCAATTATTATTAATACTGAATAATAATTAAACTCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 69843828 69901678 21 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1077 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073918	100.0	DNA replication...	Homo sapiens
XP_001163213	99.4	DNA2 DNA replic...	Pan troglodytes
P51530	100.0	DNA2-like helic...	Homo sapiens
EAW54296	98.8	hCG32858 [Homo ...	Homo sapiens
CAI17238	100.0	DNA2 DNA replic...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86988	4.5e-12	29.9	KIAA0221
AB037825	6.1e-09	27.9	KIAA1404
AB014525	1.8e-07	30.4	KIAA0625
D29677	1.3e-06	24.0	KIAA0054
AB051556	4.4e-06	27.2	KIAA1769

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014808 78 300 PF08696 DNA replication factor Dna2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014808	78	300	PF08696	DNA replication factor Dna2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTATGTTTGGGGGTATCACTC
Primer_r	: AACCCTCAAGAGAAATGGAAG
PCR product length	: 180 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	973 bp
Genome contig ID	gi89161187r_69743883
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAGTTTTTTATTTAATAAATTTTTTCTACTAATGG
Flanking genome sequence (99945 - 99896)	----+--------+--------+--------+--------+----* ATCTTAACTGTGTCAATTATTATTAATACTGAATAATAATTAAACTCAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	69843828	69901678	21	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0083

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information